shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(4921504E06Rik-shRNA-Seq4)(CAT#: AdV-SI2671WQ)

This product is a 4921504E06Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of 4921504E06Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert 4921504E06Rik-shRNA-Seq4
Related Target/Protein 4921504E06Rik
Region 3UTR
TargetSeq GCAGAAGTAATCATCTCAGGA
NCBI RefSeq NM_027600
Titer >1*10^10 GC/mL
Target Gene
Gene ID 70909
Uniprot ID Q8CET2

Related Products