shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(9130011J15Rik-shRNA-Seq3)(CAT#: AdV-SI2567WQ)

This product is a 9130011J15Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of 9130011J15Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert 9130011J15Rik-shRNA-Seq3
Related Target/Protein 9130011J15Rik
Region 3UTR
TargetSeq GATATGGAGTTTCAGTTAAAT
NCBI RefSeq NM_172396
Alternative Names Smim7
Titer >1*10^10 GC/mL
Target Gene
Gene ID 66818
Uniprot ID F8WIU9

Related Products