shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Atat1-shRNA-Seq1)(CAT#: AdV-SI3176WQ)
This product is a Atat1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Atat1 gene encodes a protein that localizes to clathrin-coated pits, where it acetylates alpha tubulin on lysine 40. The expression of Atat1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Atat1-shRNA-Seq1 |
| Related Target/Protein | Atat1 |
| Region | CDS |
| TargetSeq | CCCACAGGTGAACAACTTTGT |
| NCBI RefSeq | NM_028476 |
| Alternative Names | TAT; MEC17; C6orf134; Nbla00487; alpha-TAT; alpha-TAT1 |
| Titer | >1*10^10 GC/mL |
