shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(BBS5-shRNA-Seq2)(CAT#: AdV-SI2362WQ)
This product is a BBS5-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The BBS5 gene encodes a protein that has been directly linked to Bardet-Biedl syndrome. The primary features of this syndrome include retinal dystrophy, obesity, polydactyly, renal abnormalities and learning disabilities. The expression of BBS5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | BBS5-shRNA-Seq2 |
| Related Target/Protein | BBS5 |
| Region | CDS |
| TargetSeq | GTGGATATGTTCTTGGCTTTA |
| NCBI RefSeq | NM_152384 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Bardet-Biedl syndrome |
