shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(BTBD9-shRNA-Seq2)(CAT#: AdV-SI0915WQ)
This product is a BTBD9-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The BTBD9 gene encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. The expression of BTBD9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | BTBD9-shRNA-Seq2 |
Related Target/Protein | BTBD9 |
Region | CDS |
TargetSeq | CAGCCTTATTAGATGGTGATA |
NCBI RefSeq | NM_152733 |
Alternative Names | dJ322I12.1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Tourette Syndrome |