shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C3orf52-shRNA-Seq1)(CAT#: AdV-SI0772WQ)

This product is a C3orf52-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C3orf52 encoded protein is a TPA-induced transmembrane protein. The expression of C3orf52-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C3orf52-shRNA-Seq1
Related Target/Protein C3orf52
Region CDS
TargetSeq GCTTATGTCTTGCTGCAGTAA
NCBI RefSeq NM_024616
Alternative Names TTMP
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 79669
Uniprot ID Q5BVD1

Related Products