shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CABIN1-shRNA-Seq3)(CAT#: AdV-SI0730WQ)

This product is a CABIN1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by CABIN1 gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The expression of CABIN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert CABIN1-shRNA-Seq3
Related Target/Protein CABIN1
Region CDS
TargetSeq CTGCGATTCTATGTGCGAGTA
NCBI RefSeq NM_012295
Alternative Names CAIN; PPP3IN; KB-318B8.7
Titer >1*10^10 GC/mL
Related Diseases Glomerular podocyte injury
Target Gene
Gene ID 23523
Uniprot ID Q9Y6J0

Related Products