shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CCDC80-shRNA-Seq1)(CAT#: AdV-SI0992WQ)

This product is a CCDC80-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The CCDC80 gene promotes cell adhesion and matrix assembly. The expression of CCDC80-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert CCDC80-shRNA-Seq1
Related Target/Protein CCDC80
Region CDS
TargetSeq GAGTACGGAATGACCTACAAT
NCBI RefSeq NM_199511
Alternative Names CL2; URB; DRO1; SSG1; okuribin
Titer >1*10^10 GC/mL
Related Diseases Metabolic disease
Target Gene
Gene ID 151887
Uniprot ID Q76M96

Related Products