shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CDCA3-shRNA-Seq3)(CAT#: AdV-SI0625WQ)
This product is a CDCA3-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. CDCA3 is a potential prognostic marker that promotes cell proliferation in gastric cancer. CDCA3 overexpression resulted in the stimulation of cell growth and colony formation in vitro and xenograft tumors in vivo. Conversely, knockdown of CDCA3 inhibited these effects. The expression of CDCA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | CDCA3-shRNA-Seq3 |
| Related Target/Protein | CDCA3 |
| Region | CDS |
| TargetSeq | CTCCCAGATCTTCAGGTTCTA |
| NCBI RefSeq | NM_031299 |
| Alternative Names | GRCC8; TOME-1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Gastric cancer |