shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CIAPIN1-shRNA-Seq1)(CAT#: AdV-SI0775WQ)

This product is a CIAPIN1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. CIAPIN1 is a cytokine-induced inhibitor of apoptosis with no relation to apoptosis regulatory molecules of the BCL2 or CASP families. The expression of CIAPIN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert CIAPIN1-shRNA-Seq1
Related Target/Protein CIAPIN1
Region 3UTR
TargetSeq GAGTTGTTAGTTTACTCCATT
NCBI RefSeq NM_020313
Alternative Names DRE2; CIAE2; PRO0915; Anamorsin
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular Carcinoma
Target Gene
Gene ID 57019
Uniprot ID Q6FI81

Related Products