shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(COG6-shRNA-Seq1)(CAT#: AdV-SI3139WQ)
This product is a COG6-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The COG6 gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The expression of COG6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | COG6-shRNA-Seq1 |
| Related Target/Protein | COG6 |
| Region | CDS |
| TargetSeq | CGTGGAGATATTGAACGTAAA |
| NCBI RefSeq | NM_020751 |
| Alternative Names | COD2; SHNS; CDG2L |
| Titer | >1*10^10 GC/mL |