shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(DZIP1L-shRNA-Seq1)(CAT#: AdV-SI0636WQ)

This product is a DZIP1L-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The DZIP1L gene encoded proterin is involved in primary cilium formation. Probably acts as a transition zone protein required for localization of PKD1/PC1 and PKD2/PC2 to the ciliary membrane. The expression of DZIP1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert DZIP1L-shRNA-Seq1
Related Target/Protein DZIP1L
Region CDS
TargetSeq GCCAAGCAGAACTCTACACTA
NCBI RefSeq NM_173543
Alternative Names PKD5; DZIP2
Titer >1*10^10 GC/mL
Related Diseases Testis cancer
Target Gene
Gene ID 199221
Uniprot ID Q8IYY4

Related Products