shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(FAM124A-shRNA-Seq2)(CAT#: AdV-SI0787WQ)

This product is a FAM124A-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. FAM124A belongs to the FAM124 family. The expression of FAM124A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert FAM124A-shRNA-Seq2
Related Target/Protein FAM124A
Region CDS
TargetSeq GAAAGCGGACTTCTGCATCTT
NCBI RefSeq NM_145019
Titer >1*10^10 GC/mL
Related Diseases Mycoplasma pneumoniae pneumonia
Target Gene
Gene ID 220108
Uniprot ID Q86V42

Related Products