shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(GAGE4-shRNA-Seq2)(CAT#: AdV-SI0949WQ)

This product is a GAGE4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The GAGE4 gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The expression of GAGE4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert GAGE4-shRNA-Seq2
Related Target/Protein GAGE4
Region CDS
TargetSeq GTACAGCCTCCTGAAATGATT
NCBI RefSeq NM_001474
Alternative Names CT4.4
Titer >1*10^10 GC/mL
Related Diseases Breast Cancer
Target Gene
Gene ID 2576
Uniprot ID B7ZVY3

Related Products