shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(GOLM1-shRNA-Seq1)(CAT#: AdV-SI0632WQ)

This product is a GOLM1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by GOLM1 is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. The expression of GOLM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert GOLM1-shRNA-Seq1
Related Target/Protein GOLM1
Region CDS
TargetSeq CGAATAGAAGAGGTCACCAAA
NCBI RefSeq NM_016548
Alternative Names GP73; HEL46; GOLPH2; C9orf155; PSEC0257; bA379P1.3
Titer >1*10^10 GC/mL
Related Diseases Prostate cancer
Target Gene
Gene ID 51280
Uniprot ID Q8NBJ4

Related Products