shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Hexim1-shRNA-Seq1)(CAT#: AdV-SI3130WQ)
This product is a Hexim1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. Expression of Hexim1 gene is induced by hexamethylene-bis-acetamide in vascular smooth muscle cells. The expression of Hexim1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Hexim1-shRNA-Seq1 |
Related Target/Protein | Hexim1 |
Region | 3UTR |
TargetSeq | GCCAAGATAAACTTGTGAGAA |
NCBI RefSeq | NM_138753 |
Alternative Names | CLP1; EDG1; HIS1; MAQ1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Viral infection |