shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Hexim1-shRNA-Seq1)(CAT#: AdV-SI3130WQ)

This product is a Hexim1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. Expression of Hexim1 gene is induced by hexamethylene-bis-acetamide in vascular smooth muscle cells. The expression of Hexim1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Hexim1-shRNA-Seq1
Related Target/Protein Hexim1
Region 3UTR
TargetSeq GCCAAGATAAACTTGTGAGAA
NCBI RefSeq NM_138753
Alternative Names CLP1; EDG1; HIS1; MAQ1
Titer >1*10^10 GC/mL
Related Diseases Viral infection
Target Gene
Gene ID 10614
Uniprot ID O94992

Related Products