shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(KIAA1919-shRNA-Seq2)(CAT#: AdV-SI0673WQ)
This product is a KIAA1919-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The KIAA1919 gene may function as a sodium-dependent glucose transporter is potential channel for urea in the inner medulla of kidney. The expression of KIAA1919-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | KIAA1919-shRNA-Seq2 |
Related Target/Protein | KIAA1919 |
Region | 3UTR |
TargetSeq | CTCACTGACATCTTTGAATAA |
NCBI RefSeq | NM_153369 |
Alternative Names | NaGLT1; MFSD4B |
Titer | >1*10^10 GC/mL |
Related Diseases | Renal carcinoma |