shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Lrrtm3-shRNA-Seq1)(CAT#: AdV-SI3181WQ)
This product is a Lrrtm3-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Lrrtm3 gene may play a role in the development and maintenance of the vertebrate nervous system. The expression of Lrrtm3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Lrrtm3-shRNA-Seq1 |
| Related Target/Protein | Lrrtm3 |
| Region | CDS |
| TargetSeq | CTCTCCCATAAGTCCTTTGAA |
| NCBI RefSeq | NM_178678 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Vertebrate nervous system disease |
