shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(NECAP1-shRNA-Seq1)(CAT#: AdV-SI0971WQ)

This product is a NECAP1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The NECAP1 gene encodes a protein containing two characteristic WXXF motifs and the encoded protein localizes to clathrin-coated vesicles, where it binds components of the adapter protein complexes and aids in endocytosis. The expression of NECAP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert NECAP1-shRNA-Seq1
Related Target/Protein NECAP1
Region CDS
TargetSeq CAAGTTGTGTATCGGGAACAT
NCBI RefSeq NM_015509
Alternative Names EIEE21
Titer >1*10^10 GC/mL
Related Diseases Retinal Degeneration
Target Gene
Gene ID 25977
Uniprot ID Q9CR95

Related Products