shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(NSMAF-shRNA-Seq3)(CAT#: AdV-SI2561WQ)

This product is a NSMAF-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The NSMAF gene encodes a WD-repeat protein that binds the cytoplasmic sphingomyelinase activation domain of the 55kD tumor necrosis factor receptor and may play a role in regulating TNF-induced cellular responses such as inflammation. The expression of NSMAF-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert NSMAF-shRNA-Seq3
Related Target/Protein NSMAF
Region 3UTR
TargetSeq GCAGAGAATAGCTAAGAGATA
NCBI RefSeq NM_003580
Alternative Names FAN; GRAMD5
Titer >1*10^10 GC/mL
Related Diseases Inflammation
Target Gene
Gene ID 8439
Uniprot ID Q92636

Related Products