shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(PATL1-shRNA-Seq1)(CAT#: AdV-SI0604WQ)
This product is a PATL1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The PATL1 gene encodes a involved in deadenylation-dependent decapping of mRNAs, leading to the degradation of mRNAs. Acts as a scaffold protein that connects deadenylation and decapping machinery. The expression of PATL1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | PATL1-shRNA-Seq1 |
| Related Target/Protein | PATL1 |
| Region | CDS |
| TargetSeq | CATTACCAAGGCGGTCAACTT |
| NCBI RefSeq | NM_152716 |
| Alternative Names | Pat1b; hPat1b |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hepatitis C virus (HCV) infection |