shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SNRNP70-shRNA-Seq1)(CAT#: AdV-SI0512WQ)

This product is a SNRNP70-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by SNRNP70 is the component of the spliceosomal U1 snRNP, which is essential for recognition of the pre-mRNA 5' splice-site and the subsequent assembly of the spliceosome. Misregulation of this gene has been implicated in the mRNA splicing-major pathway. The expression of SNRNP70-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert SNRNP70-shRNA-Seq1
Related Target/Protein SNRNP70
Region 3UTR
TargetSeq CCAAGGGTAGGTGTCTCATTT
NCBI RefSeq NM_003089
Alternative Names RPU1; Snp1; U1AP; U170K; U1RNP; RNPU1Z; SNRP70; U1-70K
Titer >1*10^10 GC/mL
Related Diseases Alzheimer's Disease, Mixed Connective Tissue Disease and Systemic Lupus Erythematosus
Target Gene
Gene ID 6625
Uniprot ID P08621

Related Products