shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SPANXN4-shRNA-Seq1)(CAT#: AdV-SI0851WQ)
This product is a SPANXN4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SPANXN4 gene represents one of several duplicated family members that are located on the X chromosome. The expression of SPANXN4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | SPANXN4-shRNA-Seq1 |
| Related Target/Protein | SPANXN4 |
| Region | CDS |
| TargetSeq | GAACAGAGTTTGAAAGAGACA |
| NCBI RefSeq | NM_001009613 |
| Alternative Names | CT11.9 |
| Titer | >1*10^10 GC/mL |
