shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Srbd1-shRNA-Seq1)(CAT#: AdV-SI2610WQ)

This product is a Srbd1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Srbd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Srbd1-shRNA-Seq1
Related Target/Protein Srbd1
Region CDS
TargetSeq CTTAAGAGAAGTTCGTCAAAC
NCBI RefSeq XM_001479682
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55133
Uniprot ID Q8N5C6

Related Products