shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Tmem231-shRNA-Seq1)(CAT#: AdV-SI2672WQ)

This product is a Tmem231-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Tmem231 gene encodes a transmembrane protein, which is a component of the B9 complex involved in the formation of the diffusion barrier between the cilia and plasma membrane. Mutations in this gene cause Joubert syndrome (JBTS). The expression of Tmem231-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Tmem231-shRNA-Seq1
Related Target/Protein Tmem231
Region CDS
TargetSeq GTTCGTGATCCATGCTGTCAT
NCBI RefSeq NM_001033321
Alternative Names MKS11; JBTS20; ALYE870; PRO1886
Titer >1*10^10 GC/mL
Related Diseases Joubert syndrome
Target Gene
Gene ID 79583
Uniprot ID Q9H6L2

Related Products