shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Trmt1-shRNA-Seq1)(CAT#: AdV-SI2853WQ)
This product is a Trmt1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Trmt1 gene encodes a tRNA-modifying enzyme that acts as a dimethyltransferase, modifying a single guanine residue at position 26 of the tRNA. The expression of Trmt1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Trmt1-shRNA-Seq1 |
| Related Target/Protein | Trmt1 |
| Region | CDS |
| TargetSeq | CATCAGTGCTGACTTCTATAT |
| NCBI RefSeq | NM_198020 |
| Alternative Names | TRM1; MRT68 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Autosomal recessive intellectual disorder (ARID) |