shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(VRTN-shRNA-Seq1)(CAT#: AdV-SI0601WQ)
This product is a VRTN-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. VRTN is required for the development of thoracic vertebrae in mammals. VRTN is a novel DNA-binding transcription factor as it localizes exclusively in the nucleus, binds to DNA on a genome-wide scale and regulates the transcription of a set of genes that harbor VRTN binding motifs. The expression of VRTN-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | VRTN-shRNA-Seq1 |
| Related Target/Protein | VRTN |
| Region | CDS |
| TargetSeq | CATTGCATCTCCCTGAACACA |
| NCBI RefSeq | NM_018228 |
| Alternative Names | vertnin; C14orf115 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Development of Thoracic Vertebrae in Mammals |