shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(1700065I17Rik-shRNA-Seq2)(CAT#: AdV-SI1812WQ)

This product is a 1700065I17Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of 1700065I17Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert 1700065I17Rik-shRNA-Seq2
Related Target/Protein 1700065I17Rik
Region CDS
TargetSeq GAGATAAAGATTACCGACATG
NCBI RefSeq NM_026099
Alternative Names Tex43, Tseg7
Titer >1*10^10 GC/mL
Related Diseases Testis disease
Target Gene
Gene ID 67343
Uniprot ID C9W8M4

Related Products