shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Adipor1-shRNA-Seq3)(CAT#: AdV-SI1835WQ)
This product is a Adipor1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Adipor1 gene encodes a protein which acts as a receptor for adiponectin, a hormone secreted by adipocytes which regulates fatty acid catabolism and glucose levels. The expression of Adipor1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Adipor1-shRNA-Seq3 |
Related Target/Protein | Adipor1 |
Region | 3UTR |
TargetSeq | CTGGGATTCTTCAGAAATTAT |
NCBI RefSeq | NM_028320 |
Alternative Names | CGI45; PAQR1; ACDCR1; CGI-45; TESBP1A |
Titer | >1*10^10 GC/mL |
Related Diseases | Obesity; Diabetes |