shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Ankrd34a-shRNA-Seq1)(CAT#: AdV-SI2297WQ)

This product is a ANKRD34-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of ANKRD34-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Ankrd34a-shRNA-Seq1
Related Target/Protein Ankrd34a
Region CDS
TargetSeq CAAGAAGACCAGGCAGTATCT
NCBI RefSeq NM_001024851
Alternative Names ANKRD34
Titer >1*10^10 GC/mL
Target Gene
Gene ID 284615
Uniprot ID Q69YU3

Related Products