shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Btla-shRNA-Seq3)(CAT#: AdV-SI1730WQ)
This product is a Btla-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Btla gene is a member of the immunoglobulin superfamily and relays inhibitory signals to suppress the immune response. The expression of Btla-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Btla-shRNA-Seq3 |
| Related Target/Protein | Btla |
| Region | CDS |
| TargetSeq | CCCACAGAATATGCATCCATT |
| NCBI RefSeq | NM_177584 |
| Alternative Names | BTLA1; CD272 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Rheumatoid arthritis. |