shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Cenpc1-shRNA-Seq6)(CAT#: AdV-SI1744WQ)

This product is a Cenpc1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Cenpc1 gene is a centromere autoantigen and a component of the inner kinetochore plate. The encoded protein is required for maintaining proper kinetochore size and a timely transition to anaphase. The expression of Cenpc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Cenpc1-shRNA-Seq6
Related Target/Protein Cenpc1
Region CDS
TargetSeq CCAAATGTTCGTCGATCTAAT
NCBI RefSeq NM_007683
Alternative Names MIF2; hcp-4; CENP-C; CENPC
Titer >1*10^10 GC/mL
Target Gene
Gene ID 1060
Uniprot ID Q03188

Related Products