shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(CLMP-shRNA-Seq3)(CAT#: AdV-SI0099WQ)
This product is a CLMP-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The CLMP gene encodes a type I transmembrane protein that is localized to junctional complexes between endothelial and epithelial cells and may have a role in cell-cell adhesion. The expression of CLMP-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | CLMP-shRNA-Seq3 |
Related Target/Protein | CLMP |
Region | CDS |
TargetSeq | CCTTGCAGATTGAACCTCTGA |
NCBI RefSeq | NM_024769 |
Alternative Names | ACAM; ASAM; CSBM; CSBS |
Titer | >1*10^10 GC/mL |
Related Diseases | Congenital short bowel syndrome |