shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(COG6-shRNA-Seq2)(CAT#: AdV-SI2290WQ)

This product is a COG6-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The COG6 gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The expression of COG6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert COG6-shRNA-Seq2
Related Target/Protein COG6
Region CDS
TargetSeq GCAGGTTTAGAAATTATGGAA
NCBI RefSeq NM_020751
Alternative Names COD2; SHNS; CDG2L
Titer >1*10^10 GC/mL
Target Gene
Gene ID 57511
Uniprot ID Q9Y2V7

Related Products