shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Eif2b1-shRNA-Seq4)(CAT#: AdV-SI1914WQ)

This product is a Eif2b1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Eif2b1 gene encodes one of five subunits of eukaryotic translation initiation factor 2B (EIF2B), a GTP exchange factor for eukaryotic initiation factor 2 and an essential regulator for protein synthesis. Mutations in this gene and the genes encoding other EIF2B subunits have been associated with leukoencephalopathy with vanishing white matter. The expression of Eif2b1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Eif2b1-shRNA-Seq4
Related Target/Protein Eif2b1
Region CDS
TargetSeq CCCAGATAAGTTTAAGTACAA
NCBI RefSeq NM_145371
Alternative Names EIF2B; EIF2BA
Titer >1*10^10 GC/mL
Related Diseases Leukoencephalopathy
Target Gene
Gene ID 1967
Uniprot ID Q14232

Related Products