shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Eif4h-shRNA-Seq1)(CAT#: AdV-SI1928WQ)

This product is a Eif4h-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Eif4h gene encodes one of the translation initiation factors, which functions to stimulate the initiation of protein synthesis at the level of mRNA utilization. The expression of Eif4h-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Eif4h-shRNA-Seq1
Related Target/Protein Eif4h
Region CDS
TargetSeq CTACACAGCTTACGTAGGAAA
NCBI RefSeq NM_033561
Alternative Names WSCR1; WBSCR1; eIF-4H
Titer >1*10^10 GC/mL
Related Diseases Williams syndrome
Target Gene
Gene ID 7458
Uniprot ID Q15056

Related Products