shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(FAM129C-shRNA-Seq3)(CAT#: AdV-SI0429WQ)
This product is a FAM129C-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. Based on location and expression of FAM129C gene, this would suggest it has a role in immune system function. The expression of FAM129C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | FAM129C-shRNA-Seq3 |
Related Target/Protein | FAM129C |
Region | CDS |
TargetSeq | CGTGTGTTCTTGGTTCAGCTT |
NCBI RefSeq | NM_173544 |
Alternative Names | BCNP1; FAM129C |
Titer | >1*10^10 GC/mL |
Related Diseases | Colorectal cancer |