shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(GAGE4-shRNA-Seq1)(CAT#: AdV-SI0447WQ)
This product is a GAGE4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The GAGE4 gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The expression of GAGE4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | GAGE4-shRNA-Seq1 |
| Related Target/Protein | GAGE4 |
| Region | CDS |
| TargetSeq | CCTGAAATGATTGGGCCTATG |
| NCBI RefSeq | NM_001474 |
| Alternative Names | CT4.4 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast Cancer |
