shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(GOLM1-shRNA-Seq1)(CAT#: AdV-SI0131WQ)
This product is a GOLM1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by GOLM1 is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. The expression of GOLM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | GOLM1-shRNA-Seq1 |
| Related Target/Protein | GOLM1 |
| Region | CDS |
| TargetSeq | CGAATAGAAGAGGTCACCAAA |
| NCBI RefSeq | NM_016548 |
| Alternative Names | GP73; HEL46; GOLPH2; C9orf155; PSEC0257; bA379P1.3 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Prostate cancer |