shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(HOOK2-shRNA-Seq1)(CAT#: AdV-SI1617WQ)
This product is a HOOK2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The HOOK2 gene encodes a member of Hook proteins that are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The expression of HOOK2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | HOOK2-shRNA-Seq1 |
| Related Target/Protein | HOOK2 |
| Region | CDS |
| TargetSeq | CCAGAGACGTATGGCAACTTT |
| NCBI RefSeq | NM_013312 |
| Alternative Names | HK2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Obesity and type 2 diabetes |