shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(JMJD4-shRNA-Seq2)(CAT#: AdV-SI0115WQ)
This product is a JMJD4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. JMJD proteins are mostly epigenetic regulators that demethylate histones. The expression of JMJD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | JMJD4-shRNA-Seq2 |
| Related Target/Protein | JMJD4 |
| Region | 3UTR |
| TargetSeq | GAATCCCATCTGCTGCTGAAT |
| NCBI RefSeq | NM_023007 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |
