shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(KIAA0802-shRNA-Seq2)(CAT#: AdV-SI0182WQ)
This product is a KIAA0802-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The KIAA0802 gene plays a role in the development and maintenance of non-centrosomal microtubule bundles at the lateral membrane in polarized epithelial cells. The expression of KIAA0802-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | KIAA0802-shRNA-Seq2 |
Related Target/Protein | KIAA0802 |
Region | 3UTR |
TargetSeq | GCATGGATTATCACAGTATAA |
NCBI RefSeq | NM_015210 |
Alternative Names | SOGA2; CCDC165; MTCL1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Microtubules (MTs) growth |