shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Krtap26-1-shRNA-Seq1)(CAT#: AdV-SI2240WQ)
This product is a Krtap26-1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Krtap26-1 gene is essential for the formation of a rigid and resistant hair shaft. The expression of Krtap26-1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Krtap26-1-shRNA-Seq1 |
| Related Target/Protein | Krtap26-1 |
| Region | 3UTR |
| TargetSeq | GCTTCTTTCTGAGTAGCGATT |
| NCBI RefSeq | NM_027105 |
| Titer | >1*10^10 GC/mL |