shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(LRRC27-shRNA-Seq1)(CAT#: AdV-SI0245WQ)

This product is a LRRC27-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of LRRC27-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert LRRC27-shRNA-Seq1
Related Target/Protein LRRC27
Region CDS
TargetSeq CGTGAGCAAAGAAGATTCCAT
NCBI RefSeq NM_030626
Titer >1*10^10 GC/mL
Target Gene
Gene ID 80313
Uniprot ID Q9C0I9

Related Products