shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(NCRNA00085-shRNA-Seq3)(CAT#: AdV-SI0111WQ)

This product is a NCRNA00085-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The NCRNA00085 gene encode the sperm protein potentially involved sperm-egg fusion. The expression of NCRNA00085-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert NCRNA00085-shRNA-Seq3
Related Target/Protein NCRNA00085
Region CDS
TargetSeq CAAGCTTGAAGAGTGTGAGGA
NCBI RefSeq NM_207324
Alternative Names LET7EH; SPACA6P; LINC00085; SPACA6
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 147650
Uniprot ID W5XKT8

Related Products