shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Ola1-shRNA-Seq2)(CAT#: AdV-SI1736WQ)

This product is a Ola1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Ola1 gene encodes a member of the GTPase protein family and interacts with breast cancer-associated gene 1 (BRCA1) and BRCA1-associated RING domain protein (BARD1), and is involved in centrosome regulation. The expression of Ola1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Ola1-shRNA-Seq2
Related Target/Protein Ola1
Region CDS
TargetSeq GCTGAAGTAATGAAGTATGAA
NCBI RefSeq NM_025942
Alternative Names DOC45; GBP45; GTBP9; GTPBP9; PTD004
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 29789
Uniprot ID Q9NTK5

Related Products