shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(PLEKHA6-shRNA-Seq2)(CAT#: AdV-SI0388WQ)
This product is a PLEKHA6-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The PLEKHA6 gene is associated with psychopathology and response to treatment in schizophrenic patients.The expression of PLEKHA6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | PLEKHA6-shRNA-Seq2 |
Related Target/Protein | PLEKHA6 |
Region | 3UTR |
TargetSeq | GCCAATTTGATTTGCTAGTAT |
NCBI RefSeq | NM_014935 |
Alternative Names | PEPP3; PEPP-3 |
Titer | >1*10^10 GC/mL |
Related Diseases | Schizophrenic |