shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Ptrh2-shRNA-Seq1)(CAT#: AdV-SI2227WQ)
This product is a Ptrh2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Ptrh2 gene is a mitochondrial protein with two putative domains and possesses peptidyl-tRNA hydrolase activity, to release the peptidyl moiety from tRNA, thereby preventing the accumulation of dissociated peptidyl-tRNA that could reduce the efficiency of translation. The expression of Ptrh2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Ptrh2-shRNA-Seq1 |
| Related Target/Protein | Ptrh2 |
| Region | CDS |
| TargetSeq | CCAGATGAAGACACCCTCATT |
| NCBI RefSeq | NM_175004 |
| Alternative Names | PTH; BIT1; PTH2; PTH 2; CFAP37; IMNEPD; CGI-147 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Pancreatic disease (INMEPD) |