shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SDHAF2-shRNA-Seq1)(CAT#: AdV-SI0477WQ)

This product is a SDHAF2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SDHAF2 gene encodes a mitochondrial protein needed for the flavination of a succinate dehydrogenase complex subunit required for activity of the complex. The expression of SDHAF2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert SDHAF2-shRNA-Seq1
Related Target/Protein SDHAF2
Region CDS
TargetSeq GATATTTACTACTGGGCCACA
NCBI RefSeq NM_017841
Alternative Names PGL2; SDH5; C11orf79
Titer >1*10^10 GC/mL
Related Diseases Paraganglioma
Target Gene
Gene ID 54949
Uniprot ID Q9NX18

Related Products