shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SGMS2-shRNA-Seq2)(CAT#: AdV-SI2098WQ)

This product is a SGMS2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by SGMS2 gene is an enzyme that catalyzes this reaction primarily at the cell membrane. The expression of SGMS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert SGMS2-shRNA-Seq2
Related Target/Protein SGMS2
Region CDS
TargetSeq CCAGTGATCCTACGAACACTT
NCBI RefSeq NM_152621
Alternative Names CDL; SMS2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 166929
Uniprot ID Q8NHU3

Related Products